Full Text:   <3398>

Summary:  <1707>

Suppl. Mater.: 

CLC number: S661.2

On-line Access: 2014-04-06

Received: 2013-09-06

Revision Accepted: 2013-12-03

Crosschecked: 2014-03-13

Cited: 10

Clicked: 5991

Citations:  Bibtex RefMan EndNote GB/T7714

-   Go to

Article info.
1.  Introduction
2.  Materials and methods
3.  Results and discussion
4.  Conclusions
5. Reference List
Open peer comments

Journal of Zhejiang University SCIENCE B 2014 Vol.15 No.4 P.303-312


Development of genic SSR markers from transcriptome sequencing of pear buds* #

Author(s):  Xiao-yan Yue1, Guo-qin Liu1,2, Yu Zong1, Yuan-wen Teng1, Dan-ying Cai1

Affiliation(s):  1. State Agricultural Ministry Key Laboratory of Horticultural Plant Growth, Development & Quality Improvement, Department of Horticulture, Zhejiang University, Hangzhou 310058, China; more

Corresponding email(s):   ywteng@zju.edu.cn

Key Words:  Genic marker, Simple sequence repeat, Transcriptome, Genetic diversity, Pyrus

Share this article to: More |Next Article >>>

Xiao-yan Yue, Guo-qin Liu, Yu Zong, Yuan-wen Teng, Dan-ying Cai. Development of genic SSR markers from transcriptome sequencing of pear buds[J]. Journal of Zhejiang University Science B, 2014, 15(4): 303-312.

@article{title="Development of genic SSR markers from transcriptome sequencing of pear buds",
author="Xiao-yan Yue, Guo-qin Liu, Yu Zong, Yuan-wen Teng, Dan-ying Cai",
journal="Journal of Zhejiang University Science B",
publisher="Zhejiang University Press & Springer",

%0 Journal Article
%T Development of genic SSR markers from transcriptome sequencing of pear buds
%A Xiao-yan Yue
%A Guo-qin Liu
%A Yu Zong
%A Yuan-wen Teng
%A Dan-ying Cai
%J Journal of Zhejiang University SCIENCE B
%V 15
%N 4
%P 303-312
%@ 1673-1581
%D 2014
%I Zhejiang University Press & Springer
%DOI 10.1631/jzus.B1300240

T1 - Development of genic SSR markers from transcriptome sequencing of pear buds
A1 - Xiao-yan Yue
A1 - Guo-qin Liu
A1 - Yu Zong
A1 - Yuan-wen Teng
A1 - Dan-ying Cai
J0 - Journal of Zhejiang University Science B
VL - 15
IS - 4
SP - 303
EP - 312
%@ 1673-1581
Y1 - 2014
PB - Zhejiang University Press & Springer
ER -
DOI - 10.1631/jzus.B1300240

A total of 8375 genic simple sequence repeat (SSR) loci were discovered from a unigene set assembled from 116 282 transcriptomic unigenes in this study. Dinucleotide repeat motifs were the most common with a frequency of 65.11%, followed by trinucleotide (32.81%). A total of 4100 primer pairs were designed from the SSR loci. Of these, 343 primer pairs (repeat length ≥15 bp) were synthesized with an M13 tail and tested for stable amplification and polymorphism in four Pyrus accessions. After the preliminary test, 104 polymorphic genic SSR markers were developed; dinucleotide and trinucleotide repeats represented 97.11% (101) of these. Twenty-eight polymorphic genic SSR markers were selected randomly to further validate genetic diversity among 28 Pyrus accessions. These markers displayed a high level of polymorphism. The number of alleles at these SSR loci ranged from 2 to 17, with a mean of 9.43 alleles per locus, and the polymorphism information content (PIC) values ranged from 0.26 to 0.91. The UPGMA (unweighted pair-group method with arithmetic average) cluster analysis grouped the 28 Pyrus accessions into two groups: Oriental pears and Occidental pears, which are congruent to the traditional taxonomy, demonstrating their effectiveness in analyzing Pyrus phylogenetic relationships, enriching rare Pyrus EST-SSR resources, and confirming the potential value of a pear transcriptome database for the development of new SSR markers.




Darkslateblue:Affiliate; Royal Blue:Author; Turquoise:Article

Article Content

1.  Introduction

 The genus Pyrus is classified in subtribe Pyrinae within tribe Pyreae of the family Rosaceae (Potter et al., 2007), and includes approximately 22 well-recognized primary species as well as several natural or artificial interspecific hybrids (Bell and Zwet, 1998). It is a functionally diploid genus (2n=34) of allopolyploid origin and is believed to have arisen about 55–65 million years ago in the mountainous regions of western and southwestern China (Rubtsov, 1944). However, because pears are considered to be typically self-incompatible and interspecies compatible, phylogenetic relationships within the genus Pyrus are complicated and difficult to be established because of high heterozygosity from widespread crossing and low morphological diversity or poor differentiating characters (Teng et al., 2002; Bao et al., 2007; Yao et al., 2010; Zheng et al., 2011). Hence, more DNA-based genetic markers need to be exploited to resolve these problems.

 Simple sequence repeats (SSRs) or microsatellites are one of the most efficient genetic markers. By virtue of their reproducibility, multi-allelic nature, co-dominant inheritance, relative abundance, and good genome coverage (Powell et al., 1996), SSR markers have been largely applied to genetic diversity studies (Gupta and Varshney, 2000; Chen et al., 2011; Zhang et al., 2013) and used in a variety of applications related to pears, demonstrating their adaptability for Pyrus (Yamamoto et al., 2002; 2004; Bao et al., 2007; Katayama et al., 2007; Yao et al., 2010; Cao et al., 2012). SSR loci consist of randomly repeated DNA regions with motif lengths of one to six base pairs (bp) and are spread throughout the genome (Tóth et al., 2000). According to their locations in the genome, SSR markers are generally divided into genomic SSRs and genic SSRs (or expressed sequence tag (EST)-SSRs); in comparison with genomic SSR markers, genic SSR markers are derived from coding regions and are believed to have some intrinsic advantages, such as inexpensiveness and relative ease of obtaining, applicability to assaying functional diversity in natural populations or germ-plasm collections, high transferability to related species, and usefulness as anchor markers for comparative mapping or evolutionary studies (Varshney et al., 2005).

 However, the development of genic SSRs can be difficult because of the laborious and costly collection of ESTs (Bouck and Vision, 2006), so few pear ESTs (about 4413, before June 7, 2013) have been submitted to GenBank and few studies on the development of EST-SSR markers from Pyrus have been reported (Nishitani et al., 2009). Most of the EST-SSRs used in pear genetic diversity were derived from Malus (Yamamoto et al., 2001; Yao et al., 2010). With the development of the next-generation sequencing technology, creating transcriptome-level sequence collections has become much quicker and cheaper (Mardis, 2008). As a result, a wealth of gene-based SSRs and other genetic markers depending on such resources have been identified and developed in various plant species (Vendramin et al., 2006; Blanca et al., 2011; Dutta et al., 2011; Kaur et al., 2012; Lesser et al., 2012), but have not been reported in Pyrus.

 Although a pear genome sequence was obtained with a genome size of 512 Mbp recently (Wu et al., 2013), which provides an excellent platform for future genetic marker development and phylogenetic relationship analysis in Pyrus, SSR markers designed from ESTs or unigenes possess higher amplification rates and cross-species transferability (Barbará et al., 2007). Therefore, a transcriptome database offers an attractive alternative to complement existing SSR collections. In this study, we reported the first development of genic SSR markers in Pyrus, which adds to the available resources and provides new opportunities for assessing molecular phylogeny and genetic diversity in the Pyrus species.

2.  Materials and methods

2.1.  Plant materials and DNA extraction

 A total of 29 accessions from Pyrus were used in the development of the genic SSR markers in this study (Table 1). Genomic DNA was extracted from young leaves of these Pyrus accessions using a modified version of a cetyltrimethylammonium bromide (CTAB) protocol (Doyle and Doyle, 1987). DNA quality and quantity were checked in 1% agarose gels and Eppendorf BioSpectrometer (Eppendorf, Germany), respectively.

Table 1

List of 29 Pyrus accessions used in the polymorphism analysis
No. Accession Species Type Origin Leaf source
1 ‘Huiyangqingli’ P. pyrifolia Cultivar Guangdong, China CPGR
2 ‘Huiyangsuanli’ P. pyrifolia Cultivar Guangdong, China CPGR
3 ‘Nijisseiki’ P. pyrifolia Cultivar Japan TU
4 ‘Imamuraaki’ P. pyrifolia Cultivar Japan TU
5 ‘Jinchuanxueli’ P. pyrifolia Cultivar Japan CPGR
6 ‘Manyuanxiang’ P. ussuriensis Cultivar Liaoning, China CPGR
7 ‘Nanguoli’ P. ussuriensis Cultivar Liaoning, China CPGR
8 P. ussuriensis P. ussuriensis Wild material Liaoning, China CPGR
9 ‘Cili’ P. pyrifolia white pear group Cultivar Shandong, China CPGR
10 ‘Yali’ P. pyrifolia white pear group Cultivar Hebei, China CPGR
11 P. pashia 1 P. pashia Wild material Guizhou, China Guizhou
12 P. pashia 2 P. pashia Wild material Guizhou, China Guizhou
13 P. pashia 3 P. pashia Wild material Nepal TU
14 P. dimorphophylla P. dimorphophylla Wild material Japan TU
15 P. fauriei P. fauriei Wild material Korean TU
16 P. betulaefolia 3 P. betulaefolia Wild material Japan TU
17 P. betulaefolia 1 P. betulaefolia Wild material Lanzhou, China CPGR
18 P. betulaefolia 2 P. betulaefolia Wild material Linwu, China CPGR
19 P. serrulata P. serrulata Wild material Hebei, China CPGR
20 P. hopeiensis P. hopeiensis Wild material Hebei, China Hebei
21 P. phaeocarpa P. phaeocarpa Wild material North of China CPGR
22 P. xerophila P. xerophila Wild material Lanzhou, China GPI
23 P. hondoensis P. hondoensis Wild material Center of Japan TU
24 P. pyrifolia P. pyrifolia Wild material Japan TU
25 P. nivalis P. nivalis Wild material Europe TU
26 P. longipes P. longipes Wild material Europe TU
27 P. amygdaliformis P. amygdaliformis Wild material Mediterranean, South Europe TU
28 P. elaegrifolia P. elaegrifolia Wild material Turkey, South Europe, Crimean Peninsula TU
29 P. communis P. communis Wild material Europe TU

  • CPGR: China Pear Germplasm Repository; TU: Tottori University; GPI: Gansu Pomology Institute

  • 2.2.  Identification of SSR loci from the pear bud transcriptome

     A total of 116 282 unigenes were obtained from the ‘Suli’ pear (Pyrus pyrifolia white pear group) bud transcriptome in a previous study (Liu et al., 2012). Genic SSR loci in this pear bud transcriptome were identified from the unigene set by MIcroSAtellite identification tool (MISA) (Thiel et al., 2003), which is based on the Perl language. The SSR loci containing repeat units of 2–6 nucleotides were identified, and the minimum SSR length criteria were defined as six iterations for dinucleotide repeats, and five iterations for other repeat units.

    2.3.  Primer design and polymorphism testing of SSR loci

     BatchPrimer3 interface modules (You et al., 2008) were used to construct polymerase chain reaction (PCR) primers in the flanking regions of the SSR loci. The screening strategies for primer pairs were set as follows: 18–22 bp with an optimum size of 20 bp for the length of the primers, 60 °C for annealing temperature, 100–280 bp for the size of PCR products, and 40%–60% with an optimum of 50% for the guanine-cytosine (GC) content. Other parameters were at the default setting of the software. Three primer pairs were designed for each SSR locus, and the primer pair with the highest score was chosen as the best one.

     Primers for compound SSR types were excluded. According to the length variation analysis of microsatellites in rice, all primers with a repeat length ≥15 bp were selected, a large proportion of which are the type I SSR markers (repeat length ≥20 bp), deemed to have a high chance of showing polymorphism (Singh et al., 2010). A subset of 343 primers without more than four continuous single base repeats in the primer pairs was synthesized and tested for amplification. An economic method for fluorescent labeling of PCR fragments was adopted to test their polymorphism (Schuelke, 2000). A tail (M13 universal sequence, TGTAAAACGACGGCCAGT) was added to the 5' end of each of the 343 forward primers. The primers were synthesized by Invitrogen Trading (Shanghai) Co., Ltd. Four Pyrus accessions, ‘Huiyangqingli’, ‘Huiyangsuanli’, P. ussuriensis, and P. communis, were used to test the 343 SSR markers to confirm their amplification and polymorphism. The tail primers were labeled with the following four dyes: FAM (blue), HEX (green), NED (yellow), and PET (red). FAM-tail and HEX-tail were synthesized by Invitrogen Trading (Shanghai) Co., Ltd.; NED-tail and PET-tail by Applied Biosystems (Foster City, CA, USA).

    2.4.  PCR and polymorphic marker validation

     PCR was carried out in a final reaction volume of 20 μl, containing 20–30 ng total genomic DNA, 10× PCR buffer, 1.0 mmol/L Mg2+, 0.2 mmol/L of each dNTP, 5 pmol of each reverse primer, 4 pmol of the tail primer, 1 pmol of the forward primer, and 0.5 U Taq DNA polymerase (Sangon Biotech, Shanghai, China). Every primer’s amplification program contained two stages: after 5 min initial denaturation at 94 °C, 32 cycles were run for 30 s at 94 °C, 30 s at 58 °C and 30 s at 72 °C, followed by 8 cycles for 30 s at 94 °C, 30 s at 53 °C and 30 s at 72 °C. PCR products were electrophoresed on 3% agarose gels at 5 V/cm and stained with ethidium bromide to check their quality. Two independent PCRs were performed to confirm stable amplification.

     The primers were divided into four subsets based on their product sizes, and then amplified with the four fluorescent tail primers using the same reaction volume. The PCR products with different fluorescent tails were diluted, then mixed with the internal size standard LIZ500, and loaded onto an ABI 3130 genetic analyzer (Applied Biosystems, Foster City, CA, USA). The sizes of fragments and alleles were calculated using GeneMapper version 4.0 (Applied Biosystems, Foster City, CA, USA).

     Twenty-eight SSR markers were randomly selected from the polymorphic markers to validate genetic diversity in 28 Pyrus accessions, using the same PCR program and scoring approach. Several primers were separately amplified twice to confirm the veracity of scoring. The occurrences of null alleles at each locus were checked using MICROCHECKER 2.2.3 software (van Oosterhout et al., 2004). POPGENE version 1.32 (Yeh and Boyle, 1997) was used to calculate the frequency of the major genotypes (A), the number of genotypes (N g), the number of alleles (N a), observed heterozygosity (H o), and expected heterozygosity (H e). PowerMarker version 3.25 (Liu and Muse, 2005) was used to test for polymorphism information content (PIC). Freetree. (Pavlicek et al., 1999) was used to construct a dendrogram using UPGMA (unweighted pair-group method with arithmetic average) cluster analysis based on Nei’s genetic identity (Nei, 1973), and the confidence of the branch support was evaluated by bootstrap analysis with 1000 replicates.

    3.  Results and discussion

    3.1.  Frequency and distribution of genic SSRs in the pear bud transcriptome

     A total of 8375 SSR loci containing 2–6 bp repeat motifs were discovered from the ‘Suli’ pear bud transcriptome, representing 7.2% of the total unigenes. This frequency was a little lower than that for the EST-SSRs reported in Malus (Yao et al., 2010), but similar to the 7.0% and 7.6% for transcriptome genic SSRs from the Capsicum annuum (Ashrafi et al., 2012) and Cajanus cajan (Dutta et al., 2011), respectively. The differences between these results could be due to different identification criteria for the SSR loci. The SSR loci were distributed in 6521 (5.61%) unigenes, of which 5055 (76.03%) possessed a single SSR locus, 1466 (22.48%) contained more than one SSR, and 858 had compound SSRs (13.16%).

     Repeat motifs among these SSR loci consisted of 64 types (considering sequence complementarity), and the number of iterations of a given repeat unit varied from 5 to 18. Incidences of different repeat types and frequencies for each motif were evaluated based on the repeat unit number (Table 2). The most abundant motif was dinucleotide (65.11%), consistent with our observations of Pyrus EST-SSRs (Nishitani et al., 2009), followed by trinucleotide (32.81%). The most common class was n=6 (27.20%), containing mostly dinucleotide repeats. AG/CT comprised 86.94% of all dinucleotide motifs and was the most common type (Fig. 1a), similar to our analysis of EST-SSRs (Kantety et al., 2002; Yao et al., 2010). This is probably because the AG/CT dinucleotide motif can represent multiple codons resting within the reading frame that can be translated into different amino acids, and AG/CT could be present in the codons of Ala and Leu, which have the highest frequency in proteins (Yao et al., 2010). The predominant trinucleotide repeat motifs were AAG/CTT and AGG/CCT, which accounted for 25.29% and 20.74%, respectively (Fig. 1b).

    Table 2

    Frequencies of different SSR repeat motif types observed in the ‘Suli’ pear bud transcriptome
    SSR motif Repeat number
    Percentage (%)
    5 6 7 8 9 10 11 >11 Total
    Dinucleotide 0 1532 994 888 1073 782 173 11 5453 65.11
    Trinucleotide 1637 709 344 38 15 0 2 3 2748 32.81
    Tetranucleotide 106 33 0 3 0 0 0 1 143 1.71
    Pentanucleotide 18 1 0 0 0 0 0 0 19 0.22
    Hexanucleotide 7 3 1 1 0 0 0 0 12 0.14
    Total 1768 2278 1339 930 1088 782 175 15 8375 100.00

    Percentage (%) 21.11 27.20 15.99 11.10 12.99 9.34 2.09 0.17 100.00

    Percentages of different motifs among dinucleotide (a) and trinucleotide (b) repeats in the ‘Suli’ pear bud transcriptome

    3.2.  Development of genic SSR markers and polymorphism detection

     Of the 8375 SSR loci, primer pairs were successfully designed for 4100 loci. A total of 343 primer pairs, including 184 (53.64%) for dinucleotide repeats, 147 (42.86%) for trinucleotide repeats, 6 (1.75%) for tetranucleotide repeats, 5 (1.46%) for pentanucleotide repeats, and 1 (0.29%) for a hexanucleotide repeat, were synthesized to amplify SSRs in four Pyrus accessions. Stable amplification of products of expected size was confirmed for 152 SSR primer pairs (44.31% of tested SSR primer pairs) in the preliminary test, a success rate comparable to 48.5% for Saccharum (Cordeiro et al., 2001), but lower than 92.2% for Linum usitatissimum (Cloutier et al., 2009) and 80.0% for Cajanus cajan (Dutta et al., 2011). The lack of amplification could be because some flanking primer pairs were designed across a splice site or chimeric cDNA sequence (Varshney et al., 2006). Although the primer pairs were designed with an annealing temperature of 60 °C, the majority were amplified at 58 °C to maximize the availability of genic markers for Pyrus.

     Polymorphism was confirmed for 104 SSR markers (Table S1) with PCR products ranging from 110 to 270 bp. The polymorphic ratio was 68.42% (104/152), which was higher than 51.09% for Pinus (Lesser et al., 2012) and 29.6% for Vicia faba (Kaur et al., 2012), probably because the type I genic SSRs showed a high level of polymorphism or because of high heterozygosity in the Pyrus (Wu et al., 2013). Dinucleotide and trinucleotide motifs represented 97.11% (101/104) of the polymorphic SSRs, which was in agreement with higher-order repeat motifs being less polymorphic than lower-order repeats (Dreisigacker et al., 2004). In addition, no AT/TA was found among these polymorphic markers; AT/TA is not usually used to develop markers because its self-complementary nature leads to the formation of dimers (Wang et al., 2011).

    3.3.  Functional annotation for SSR-containing unigene sequences

     All SSR-containing unigene sequences were used for searching homology proteins in the National Central for Biotechnology Information (NCBI) database. Only 47.9% of the unigene sequences containing SSR loci were BLAST-annotated in the previous transcriptome analysis. This may be because the transcriptome unigenes were sequenced directly instead of after cloning, which makes new rare transcript discovery easier (Wang et al., 2009). Among these polymorphic SSR loci, 47.12% of the SSR-containing unigene sequences showed significant hits in the NCBI non-redundant protein database, and their putative functions were mostly correlated with specific biological activities (Table S1). For example, the unigene sequence containing the TXY86 SSR locus was similar to the gene of farnesyl pyrophosphate synthase (FPPS), a key branch-point enzyme in the mevalonate pathway, which is involved in the syntheses of cytokinins, abscisic acid, and gibberellins required in essential biological processes (Reilly et al., 2002). These markers with particular significance can be further applied in molecular breeding to facilitate genetic improvement of the pear.

    3.4.  Assessment of the genetic relationship among 28 Pyrus accessions by genic SSR markers

     The applicability of the polymorphic genic SSR markers in Pyrus was validated in 28 accessions (Table 3). The PCR product sizes of the 28 genic SSR markers were 102–268 bp, and corresponded to the expected sizes for each primer. The number of alleles detected at these 28 loci ranged from 2 to 17 with an average of 9.42 alleles per locus. The observed heterozygosity at the different loci ranged from 0.14 (TXY16) to 0.89 (TXY104) with a mean of 0.49, which was lower than 0.63 reported in genomic SSR marker analysis in Pyrus (Kimura et al., 2002; Bao et al., 2007), consistent with the expectation that gene-based SSRs developed from transcribed regions are less polymorphic than genome-derived SSRs. However, this was similar to values of 0.44 for Malus EST-SSRs in European pears (Wünsch and Hormaza, 2007) and 0.48 for Pyrus EST-SSRs in identification of European and Asian pears (Bassil and Postman, 2010). Another important index of the level of polymorphism, PIC values, displayed high polymorphism at each locus, ranging from 0.26 to 0.91 with an average of 0.75.

    Table 3

    Characteristics of the 28 polymorphic SSR markers validated in 28 Pyrus accessions
    Locus Repeat motif Primer sequence (5'–3') Size range (bp) A N g N a H o H e PIC
    XY121 (CT)8 F: ACTGCTTGTAACACCCAACG; R: CGGAGTCAGTTGGATATCGG 102–158 0.3333 25 16 0.6071 0.8714 0.8460
    TXY86 (AG)8 F: TTGGGTCTTTAAATGCCAGC; R: CCAGACGTGAGTTGTTGCC 114–156 0.1667 28 17 0.8214 0.9318 0.9091
    TXY170 (CAT)9 F: TGCCTTTCCATTCTCAGGTC; R: AAGCGGCTGTCTAAATGAACA 104–144 0.3611 17 8 0.6071 0.7571 0.7095
    TXY88 (AG)8 F: GAGGGAGAGAGGAAGCCATT; R: CACAAGCTTTGTATTCGGCA 110–150 0.3472 18 11 0.4286 0.8123 0.7730
    TXY5 (TG)8 F: GGAGCAATGTGTGTTGTCACT; R: CCTTGCGATCGATAATTTCC 118–146 0.2222 22 9 0.4643 0.8766 0.8459
    TXY276 (CAGCT)5 F: CCCTACAGAGTCATGCATCC; R: TTGATGCTGGAGACGAGAAA 119–144 0.5714 12 6 0.4074 0.6408 0.5882
    TXY11 (TC)8 F: CAGAATTCAACATTCACTCTCTCTC; R: GAGTAGGGATGTGTCGGCTC 120–166 0.3235 13 9 0.2692 0.8228 0.7814
    TXY15 (TC)8 F: CAGGCTAGGGTTCAGGGTTT; R: CCTTTGAAGCCAAAGACTCG 146–184 0.2500 23 14 0.6429 0.8565 0.8250
    TXY102 (AC)8 F: CTCTTAACCCTCTCTCCCCC; R: CCCGATGACTCTTGAATGGT 159–183 0.2639 21 12 0.5000 0.8532 0.8204
    TXY16 (TC)8 F: TTGCTGAAGCTTCTCTTCTTCTC; R: GAGCCCACAAGGGTTCAATA 160–210 0.2500 19 8 0.1429 0.7766 0.7362
    TXY267 (TC)9 F: GTCTTAGCTTCTGCTCCCGA; R: AACCTGATGAGAATGACGGG 149–195 0.1944 21 12 0.4286 0.8909 0.8625
    TXY63 (CT)8 F: ACCTGTCATCACTTCTACTGGTTA; R: AGCCTACAAACATGCATCCC 169–189 0.1944 24 11 0.4643 0.8903 0.8623
    TXY94 (AG)8 F: ACACGCGCACACAGAGATAC; R: CCGTCACGTCGCTTTCTT 172–206 0.2083 26 14 0.5000 0.8961 0.8689
    TXY95 (AG)8 F: TACGGACAAGGACACCATGA; R: CTTGACGGTGTCAAAGGGAT 177–205 0.4028 14 10 0.5000 0.7721 0.7240
    TXY236 (TCC)6 F: TCCACTCCAAACCCAGAAAC; R: GCTTCAGGGAAGCTGAAATG 183–189 0.7571 4 2 0.2222 0.3075 0.2562
    TXY185 (CAG)7 F: GGAGGACCAACAGCAACATT; R: AGCAAGATCAAGCCAGGTGT 181–196 0.3889 11 6 0.4643 0.7682 0.7134
    TXY2 (AC)9 F: ACGCTTCAGGTTTGGACTTC; R: TCAACCTGGACCATACATTCA 172–206 0.2083 22 10 0.5714 0.8656 0.8325
    TXY280 (AAGG)5 F: CGTCCAAACTCCTCAGCTTC; R: CTCTGTCTGTCTGGTCGGGT 187–215 0.2778 17 8 0.6786 0.8253 0.7845
    TXY150 (TC)9 F: GCCTTGGGCTTCTTCTTCTT; R: TCGTCGTGTGATTCGACTTC 190–216 0.4583 14 8 0.3929 0.7370 0.6898
    TXY219 (GTG)6 F: CTAAGAAGCCGTTCCGATGA; R: GTCTCCCATCCTCCTCTTCC 194–218 0.5556 11 7 0.3929 0.6792 0.6304
    TXY45 (GA)8 F: CAGACCCCAATTCAACGTCT; R: TCTTCTGGACATGGAGGACC 184–230 0.4167 14 7 0.5000 0.7409 0.6956
    TXY214 (ACC)6 F: AACCTAAACGCATTGCAACC; R: AAGATGTGAAACCGAAACCG 202–235 0.2361 16 9 0.8214 0.8474 0.8109
    TXY25 (TC)8 F: TCGATTCGATCAGGTGCTAA; R: CCGTCTCTCTTTCTCCGTTG 145–235 0.3194 18 10 0.3929 0.7773 0.7338
    TXY138 (GCC)6 F: AGCATTTCCGCTGTCAGAAT; R: ATGAAGTCGTCCAGAGCGTT 218–230 0.3750 11 5 0.5357 0.7565 0.7014
    TXY48 (GA)8 F: ACTAGGCAAACCAATCCAGC; R: TTGGGATCTTGTGAAGAGGG 221–245 0.4032 13 8 0.2500 0.7385 0.6923
    TXY144 (GAG)11 F: ACGGAGAAGAAGCAGCAGAG; R: ACAATCTCATCCTCAACGCC 216–228 0.5161 8 5 0.1667 0.7048 0.6490
    TXY104 (AC)8 F: CCCTTGATACTCAAACCCTCC; R: GATCGTTCCTTCACCAGCAT 238–270 0.3286 17 13 0.8889 0.8519 0.8204
    TXY164 (TGC)5 F: CACACGAATAGCTCCTGCAA; R: AGCATCAGCAACAGCAACAG 241–268 0.2917 16 9 0.6071 0.8279 0.7903
    Mean 0.3437 16.96 9.429 0.4882 0.7884 0.7483

  • <FAM>, <HEX>, <NED>, and <PET> represent four different fluorescent labels; <Tail> represents the M13 universal primer (TGTAAAACG ACGGCCAGT) added to the 5' end of forward primers. Shown for each primer pair are the repeat motif, primer sequence, size range (bp), major allele frequency (A), number of genotypes (N g), number of alleles (N a), observed heterozygosity (H o), expected heterozygosity (H e), and polymorphism information content (PIC)

  •  The UPGMA cluster analysis divided the 28 Pyrus accessions into two groups, Oriental pears and Occidental pears, with a 100% confidence coefficient (Fig. 2), which was similar to many previous related studies (Teng and Tanabe, 2004; Bao et al., 2007; Yao et al., 2010), demonstrating the applicability of genic SSRs from transcriptomic unigenes in Pyrus.

    Dendrogram for 28 Pyrus accessions derived from UPGMA analysis of 28 highly polymorphic SSR markers
    The numbers are bootstrap values based on 1000 iterations; only values larger than 50 are included

     In addition, the Oriental pear cluster contained two subgroups: A1, consisting of three P. betulifolia accessions, and A2, which clustered the other cultivars and species together. The position of P. betulifolia at the first independent branch in the Oriental pears might be related to its older origin (Zheng et al., 2011), which was confirmed by recent phylogenetic research from our research group (unpublished data). The species and cultivars in A2 displayed a complex relationship with a lower confidence coefficient, probably due to wide hybridization within Pyrus (Aldasoro et al., 1996). Some species of unknown or controversial origin were also included in this validation experiment, such as P. hopeiensis and P. phaeocarpa. P. hopeiensis was grouped together with P. pashia, and P. phaeocarpa clustered with P. serrulata, indicating their hybrid origins (Zheng et al., 2011). In addition, P. ussuriensis and ‘Yali’ formed a branch in agreement with Yao (2010). ‘Cili’, another cultivar from the P. pyrifolia white pear group, clustered with P. pyrifolia from Japan, which supports the viewpoint that Chinese white pears are a variety or ecotype of P. pyrifolia (P. pyrifolia white pear group) (Teng and Tanabe, 2004; Bao et al., 2007; Zheng et al., 2011).

     These polymorphic gene-based SSR markers can be used to support germ-plasm enhancement, population structure, and genetic diversity to understand the genetic architecture of important agronomic traits in Pyrus, or transferred to other species in the subfamily for further research. In addition, these polymorphic SSR loci located in SSR-containing unigene sequences with putative special functions can be combined with phenotypic data to extend their applications in germ-plasm evaluation and examining the functional diversity at a certain locus.

    4.  Conclusions

     This is the first report of genic SSR marker development in Pyrus from transcriptomic unigenes by next generation deep sequencing technology. A total of 8375 genic SSR loci were discovered from transcriptomic unigenes and a set of 104 (30.3% in 343) genic SSR markers were developed to enrich rare Pyrus EST-SSRs and provide additional tools for genetic analysis in the genus Pyrus. Twenty-eight polymorphic loci were further validated in 28 accessions and showed high polymorphism, demonstrating their effectiveness in analyzing Pyrus genetic relationships and confirming the potential value of a pear transcriptome database for the development of new SSR markers.

    * Project supported by the National Natural Science Foundation of China (No. 31201592), the Modern Agro-industry Technology Research System (No. nycytx-29-14), and the Doctoral Program of Higher Education (No. 20110101110091), China# Electronic supplementary materials: The online version of this article (http://dx.doi.org/10.1631/jzus.B1300240) contains supplementary materials, which are available to authorized usersCompliance with ethics guidelines Xiao-yan YUE, Guo-qin LIU, Yu ZONG, Yuan-wen TENG, and Dan-ying CAI declare that they have no conflict of interest.


    [1] Aldasoro, J.J., Aedo, C., Garmendia, F.M., 1996. The genus Pyrus L. (Rosaceae) in south-west Europe and North Africa. Bot J Linn Soc, 121(2):143-158. 

    [2] Ashrafi, H., Hill, T., Stoffel, K., 2012. De novo assembly of the pepper transcriptome (Capsicum annuum): a benchmark for in silico discovery of SNPs, SSRs and candidate genes. BMC Genomics, 13(1):571

    [3] Bao, L., Chen, K., Zhang, D., 2007. Genetic diversity and similarity of pear (Pyrus L.) cultivars native to East Asia revealed by SSR (simple sequence repeat) markers. Genet Resour Crop Ev, 54(5):959-971. 

    [4] Barbar, T., Palma-Silva, C., Paggi, G.M., 2007. Cross-species transfer of nuclear microsatellite markers: potential and limitations. Mol Ecol, 16(18):3759-3767. 

    [5] Bassil, N., Postman, J.D., 2010. Identification of European and Asian pears using EST-SSRs from PyrusGenet Resour Crop Ev, 57(3):357-370. 

    [6] Bell, R.L., Zwet, T., 1998. Breeding for host resistance to pear psylla: evaluation of parental germplasm. Acta Hortic (ISHS), 484:471-476. 

    [7] Blanca, J., Cañizares, J., Roig, C., 2011. Transcriptome characterization and high throughput SSRs and SNPs discovery in Cucurbita pepo (Cucurbitaceae). BMC Genomics, 12(1):104

    [8] Bouck, A., Vision, T., 2006. The molecular ecologist’s guide to expressed sequence tags. Mol Ecol, 16(5):907-924. 

    [9] Cao, Y., Tian, L., Gao, Y., 2012. Genetic diversity of cultivated and wild Ussurian Pear (Pyrus ussuriensis Maxim.) in China evaluated with M13-tailed SSR markers. Genet Resour Crop Ev, 59(1):9-17. 

    [10] Chen, X., Sun, D., Rong, D., 2011. A recessive gene controlling male sterility sensitive to short daylength/low temperature in wheat (Triticum aestivum L.). J Zhejiang Univ-Sci B (Biomed & Biotechnol), 12(11):943-950. 

    [11] Cloutier, S., Niu, Z., Datla, R., 2009. Development and analysis of EST-SSRs for flax (Linum usitatissimum L.). Theor Appl Genet, 119(1):53-63. 

    [12] Cordeiro, G.M., Casu, R., McIntyre, C.L., 2001. Microsatellite markers from sugarcane (Saccharum spp.) ESTs cross transferable to erianthus and sorghum. Plant Sci, 160(6):1115-1123. 

    [13] Doyle, J., Doyle, J., 1987. Genomic plant DNA preparation from fresh tissue-CTAB method. Phytochem Bull, 19(11):11-15. 

    [14] Dreisigacker, S., Zhang, P., Warburton, M.L., 2004. SSR and pedigree analyses of genetic diversity among CIMMYT wheat lines targeted to different megaenvironments. Crop Sci, 44(2):381-388. 

    [15] Dutta, S., Kumawat, G., Singh, B.P., 2011. Development of genic-SSR markers by deep transcriptome sequencing in pigeonpea [Cajanus cajan (L.) Millspaugh]. BMC Plant Biol, 11(1):17

    [16] Gupta, P., Varshney, R., 2000. The development and use of microsatellite markers for genetic analysis and plant breeding with emphasis on bread wheat. Euphytica, 113(3):163-185. 

    [17] Kantety, R.V., La Rota, M., Matthews, D.E., 2002. Data mining for simple sequence repeats in expressed sequence tags from barley, maize, rice, sorghum and wheat. Plant Mol Biol, 48(5-6):501-510. 

    [18] Katayama, H., Adachi, S., Yamamoto, T., 2007. A wide range of genetic diversity in pear (Pyrus ussuriensis var. aromatica) genetic resources from Iwate, Japan revealed by SSR and chloroplast DNA markers. Genet Resour Crop Ev, 54(7):1573-1585. 

    [19] Kaur, S., Pembleton, L.W., Cogan, N.O., 2012. Transcriptome sequencing of field pea and faba bean for discovery and validation of SSR genetic markers. BMC Genomics, 13(1):104

    [20] Kimura, T., Shi, Y.Z., Shoda, M., 2002. Identification of Asian pear varieties by SSR analysis. Breed Sci, 52(2):115-121. 

    [21] Lesser, M.R., Parchman, T., Buerkle, C., 2012. Cross-species transferability of SSR loci developed from transcriptome sequencing in lodgepole pine. Mol Ecol Resour, 12(3):448-455. 

    [22] Liu, G., Li, W., Zheng, P., 2012. Transcriptomic analysis of ‘Suli’ pear (Pyrus pyrifolia white pear group) buds during the dormancy by RNA-Seq. BMC Genomics, 13(1):700

    [23] Liu, K., Muse, S.V., 2005. PowerMarker: an integrated analysis environment for genetic marker analysis. Bioinformatics, 21(9):2128-2129. 

    [24] Mardis, E.R., 2008. The impact of next-generation sequencing technology on genetics. Trends Genet, 24(3):133-141. 

    [25] Nei, M., 1973. Analysis of gene diversity in subdivided populations. PNAS, 70(12):3321-3323. 

    [26] Nishitani, C., Terakami, S., Sawamura, Y., 2009. Development of novel EST-SSR markers derived from Japanese pear (Pyrus pyrifolia). Breed Sci, 59(4):391-400. 

    [27] Pavlicek, A., Hrda, S., Flegr, J., 1999. Free-tree—freeware program for construction of phylogenetic trees on the basis of distance data and bootstrap/jackknife analysis of the tree robustness. Application in the RAPD analysis of genus FrenkeliaFolia Biol (Praha), 45(3):97-99. 

    [28] Potter, D., Eriksson, T., Evans, R.C., 2007. Phylogeny and classification of Rosaceae. Plant Syst Evol, 266(1-2):5-43. 

    [29] Powell, W., Machray, G.C., Provan, J., 1996. Polymorphism revealed by simple sequence repeats. Trends Plant Sci, 1(7):215-222. 

    [30] Reilly, J.F., Martinez, S.D., Mickey, G., 2002. A novel role for farnesyl pyrophosphate synthase in fibroblast growth factor-mediated signal transduction. Biochem J, 366(2):501-510. 

    [31] Rubtsov, G.A., 1944. Geographical distribution of the genus Pyrus and trends and factors in its evolution. Am Nat, 78(777):358-366. 

    [32] Schuelke, M., 2000. An economic method for the fluorescent labeling of PCR fragments. Nat Biotechnol, 18(2):233-234. 

    [33] Singh, H., Deshmukh, R.K., Singh, A., 2010. Highly variable SSR markers suitable for rice genotyping using agarose gels. Mol Breed, 25(2):359-364. 

    [34] Teng, Y., Tanabe, K., 2004. Reconsideration on the origin of cultivated pears native to East Asia. Acta Hortic, 634:175-182. 

    [35] Teng, Y., Tanabe, K., Tamura, F., 2002. Genetic relationships of Pyrus species and cultivars native to East Asia revealed by randomly amplified polymorphic DNA markers. J Am Soc Hortic Sci, 127(2):262-270. 

    [36] Thiel, T., Michalek, W., Varshney, R., 2003. Exploiting EST databases for the development and characterization of gene-derived SSR-markers in barley (Hordeum vulgare L.). Theor Appl Genet, 106(3):411-422. 

    [37] Tth, G., Gspri, Z., Jurka, J., 2000. Microsatellites in different eukaryotic genomes: survey and analysis. Genome Res, 10(7):967-981. 

    [38] van Oosterhout, C., Hutchinson, W.F., Wills, D.P., 2004. MICRO-CHECKER: software for identifying and correcting genotyping errors in microsatellite data. Mol Ecol Notes, 4(3):535-538. 

    [39] Varshney, R.K., Graner, A., Sorrells, M.E., 2005. Genic microsatellite markers in plants: features and applications. Trends Biotechnol, 23(1):48-55. 

    [40] Varshney, R.K., Grosse, I., Hhnel, U., 2006. Genetic mapping and BAC assignment of EST-derived SSR markers shows non-uniform distribution of genes in the barley genome. Theor Appl Genet, 113(2):239-250. 

    [41] Vendramin, E., Dettori, M.T., Giovinazzi, J., 2006. A set of EST-SSRs isolated from peach fruit transcriptome and their transportability across Prunus species. Mol Ecol Notes, 7(2):307-310. 

    [42] Wang, Y.W., Samuels, T.D., Wu, Y.Q., 2011. Development of 1030 genomic SSR markers in switchgrass. Theor Appl Genet, 122(4):677-686. 

    [43] Wang, Z., Gerstein, M., Snyder, M., 2009. RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet, 10(1):57-63. 

    [44] Wu, J., Wang, Z., Shi, Z., 2013. The genome of the pear (Pyrus bretschneideri Rehd.). Genome Res, 23(2):396-408. 

    [45] Wnsch, A., Hormaza, J.I., 2007. Characterization of variability and genetic similarity of European pear using microsatellite loci developed in apple. Sci Hortic, 113(1):37-43. 

    [46] Yamamoto, T., Kimura, T., Sawamura, Y., 2001. SSRs isolated from apple can identify polymorphism and genetic diversity in pear. Theor Appl Genet, 102(6-7):865-870. 

    [47] Yamamoto, T., Kimura, T., Shoda, M., 2002. Genetic linkage maps constructed by using an interspecific cross between Japanese and European pears. Theor Appl Genet, 106(1):9-18. 

    [48] Yamamoto, T., Kimura, T., Soejima, J., 2004. Identification of quince varieties using SSR markers developed from pear and apple. Breed Sci, 54(3):239-244. 

    [49] Yao, L., Zheng, X., Cai, D., 2010. Exploitation of Malus EST-SSRs and the utility in evaluation of genetic diversity in Malus and PyrusGenet Resour Crop Ev, 57(6):841-851. 

    [50] Yeh, F., Boyle, T.J.B., 1997. Population genetic analysis of codominant and dominant markers and quantitative traits. Belg J Bot, 129:157

    [51] You, F.M., Huo, N., Gu, Y.Q., 2008. BatchPrimer3: a high throughput web application for PCR and sequencing primer design. BMC Bioinformatics, 9(1):253

    [52] Zhang, G., Xu, S., Mao, W., 2013. Determination of the genetic diversity of vegetable soybean [Glycine max (L.) Merr.] using EST-SSR markers. J Zhejiang Univ-Sci B (Biomed & Biotechnol), 14(4):279-288. 

    [53] Zheng, X., Hu, C., Spooner, D., 2011. Molecular evolution of Adh and LEAFY and the phylogenetic utility of their introns in Pyrus (Rosaceae). BMC Evol Biol, 11(1):255

    Open peer comments: Debate/Discuss/Question/Opinion


    Please provide your name, email address and a comment

    Journal of Zhejiang University-SCIENCE, 38 Zheda Road, Hangzhou 310027, China
    Tel: +86-571-87952783; E-mail: cjzhang@zju.edu.cn
    Copyright © 2000 - 2023 Journal of Zhejiang University-SCIENCE